Tek-Tips is the largest IT community on the Internet today!

Members share and learn making Tek-Tips Forums the best source of peer-reviewed technical information on the Internet!

  • Congratulations TouchToneTommy on being selected by the Tek-Tips community for having the most helpful posts in the forums last week. Way to Go!

Search results for query: *

  • Users: dmcmunn
  • Content: Threads
  • Order by date
  1. dmcmunn

    Agile Data Warehousing?

    Given the "almost chaos" level complexity of building business intelligence enabled enterprise data warehouses in today's world of rapidly changing multi-organization, multi-merger/acquisition, multi-national, multi-lingual corporate world, what are some agile methodologies or practices...
  2. dmcmunn

    SSIS on 64-bit platforms

    For those of you moving to the wonderful world of 64-bit SQL Server 2005 and SSIS. I want to share a few of the items I have learned along the way. 1. First, make sure your 64-bit SQL 2005 is updates with SP1 and all the hotfixes for SSIS _BEFORE_ deployment of your packages and definitely...
  3. dmcmunn

    Multiple Calendars?

    Has anyone architected a project with multiple calendars in the same project? Some of my team's challenge for a supply chain effort is being able to map calendars from different suppliers into the internal distributor's Gregorian/fiscal calendar for purposes of performance comparison. Each...
  4. dmcmunn

    Finding object's folder name MSTR 8.x web ???

    When I search for a report object in MicroStrategy 8.x web client, the resulting hits provide links to the highest level folder, but not the sub-folder which actually contains the report. Is there a web/client preference or other setting which will provide the fully qualified path to the...
  5. dmcmunn

    Ignoring attribute in report heading for other attributes below

    I need to have an attribute's description shown in the heading of a report, whose ID is used in ApplyComparison() filters for each of the metrics contained on the report below. Unfortunately, I also need another attribute on each row of the report which I do *NOT* want filtered by the...
  6. dmcmunn

    Don't laugh...any v6.5 developers still around ????

    <<Cross posted in the developers forum as well...my apologies...>> HELPPP!!!! I've been stuck updating an ancient MicroStrategy v6.5 project. Only problem is I can't remember how to get a metric threshold to stay put after defining it for a given report. I can define the threshold when the...
  7. dmcmunn

    Hierarchy prompt start with Qualify XSL ?

    Oh Ye of the MicroStrategy Guru's, Customer wants to have the flexibility of a hierarchy prompt (range, in list, between, etc...) that contains only one attribute of a current hierarchy. This I can do. The problem is they want to start with the Qualify tab initially selected in the web...
  8. dmcmunn

    Permutations

    I'm looking for a reference on how to best to design a class for handling variable length pattern matching in permuations of a variable length string, for a genome search project on which I am embarking. Example: Source CCGGGCACTGATGAGACAGCGGCTGTTTGA Offset 123456789.123456789.123456789...
  9. dmcmunn

    Final pass keep lookups w/filter; drill needs metric filter

    MicroStrategy v7.2.2 Report requires "Preserve lookup table elements joined to final pass result table based on template attributes w/filter" checked. Not sure if this is an impact, but due to having a report totals metric repeated across all rows, I also have the "Downward Outer Join Option"...
  10. dmcmunn

    Documenting Job/steps

    Here's a query to assist in documenting jobs and job steps for purposes of review and analysis the spreadsheet of your choice. select j.job_id , j.name , j.description , j.enabled , j.start_step_id , j.date_created , j.date_modified , s.step_id , s.step_name , s.subsystem ...
  11. dmcmunn

    Automated SQL capture to disk for static reports

    Below is a little web API hack I put together to locate static reports (in sub folders named 'UNIT TEST'), generate SQL for each report and capture the SQL into a date/time stamped filename on a drive local to the web server. It can assist with automating some of the mundane checks needed after...
  12. dmcmunn

    Need to &quot;unmerge&quot; excel column/row headers

    Can someone point me in the right direction on what to change, so reports exported into Excel have their Row and Column Headers unmerged (with respect to Excel) ? Is there an XSL that can be manipulated to modify the default format by project ? The users have requested to be able to manually...
  13. dmcmunn

    Report object documentation

    Here's a query I've used to get up to speed on a new project via SQL...You can cut and paste the results into your tool of choice and sort things out... /* SQL Used to generate documentation * Server: MYMETADATA * Database: MSImd; Schema Owner: MSImd * MSI Project Name: MYOLAPDEV *...
  14. dmcmunn

    ApplySimple() SQL Server UDF and Object Prompts ?

    Greetings from Business Requirements Hell... Has anyone found a way to use a Microstrategy object prompt to supply a parameter to a SQL Server 2000 user-defined function as part of an ApplySimple() ? The KB indicates it has only been tried and supports the use of "value prompts". I confirmed...

Part and Inventory Search

Back
Top